90
|
KLA Tencor
surf scan sp-1 Surf Scan Sp 1, supplied by KLA Tencor, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/s%2E+pneumoniae+(amri+sp1)/particle+counter+kla+tencor+sp+1/us10093830-113-10-14 Average 90 stars, based on 1 article reviews
surf scan sp-1 - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
96
|
Bruker Corporation
daltonics esi compass data analysis version 4 0 sp 1 Daltonics Esi Compass Data Analysis Version 4 0 Sp 1, supplied by Bruker Corporation, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/s%2E+pneumoniae+(amri+sp1)/S2+PICOFOX/10__1016_slash_j__bmc__2013__10__044-41-6-15 Average 96 stars, based on 1 article reviews
daltonics esi compass data analysis version 4 0 sp 1 - by Bioz Stars,
2026-10
96/100 stars
|
Buy from Supplier |
94
|
Cell Signaling Technology Inc
sp 1 Sp 1, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/s%2E+pneumoniae+(amri+sp1)/SP1+Antibody/pmc07295630-19-8-27 Average 94 stars, based on 1 article reviews
sp 1 - by Bioz Stars,
2026-10
94/100 stars
|
Buy from Supplier |
93
|
Addgene inc
plasmid pegfp sp 1 Plasmid Pegfp Sp 1, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/s%2E+pneumoniae+(amri+sp1)/pEGFP-Sp1+(Plasmid+%2339325)/pm26359943-56-1-8 Average 93 stars, based on 1 article reviews
plasmid pegfp sp 1 - by Bioz Stars,
2026-10
93/100 stars
|
Buy from Supplier |
95
|
Cell Signaling Technology Inc
anti sp 1 Anti Sp 1, supplied by Cell Signaling Technology Inc, used in various techniques. Bioz Stars score: 95/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/s%2E+pneumoniae+(amri+sp1)/SP1+Rabbit+mAb/pmc06988170-48-5-6 Average 95 stars, based on 1 article reviews
anti sp 1 - by Bioz Stars,
2026-10
95/100 stars
|
Buy from Supplier |
99
|
Santa Cruz Biotechnology
sp 1 Sp 1, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 99/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/s%2E+pneumoniae+(amri+sp1)/Sp1+Antibody/pm19885584-70-16-19 Average 99 stars, based on 1 article reviews
sp 1 - by Bioz Stars,
2026-10
99/100 stars
|
Buy from Supplier |
90
|
OriGene
sp 1 cdna Sp 1 Cdna, supplied by OriGene, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/s%2E+pneumoniae+(amri+sp1)/SP1+(NM_001251825)+Human+Untagged+Clone/pm22182699-50-0-2 Average 90 stars, based on 1 article reviews
sp 1 cdna - by Bioz Stars,
2026-10
90/100 stars
|
Buy from Supplier |
96
|
Proteintech
sp 1 Sp 1, supplied by Proteintech, used in various techniques. Bioz Stars score: 96/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/s%2E+pneumoniae+(amri+sp1)/SP1+Antibody/pm31002343-67-22-15 Average 96 stars, based on 1 article reviews
sp 1 - by Bioz Stars,
2026-10
96/100 stars
|
Buy from Supplier |
92
|
Biosynth Carbosynth
sp 1 7 Sp 1 7, supplied by Biosynth Carbosynth, used in various techniques. Bioz Stars score: 92/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/s%2E+pneumoniae+(amri+sp1)/SP1/pmc02231189-220-8-18 Average 92 stars, based on 1 article reviews
sp 1 7 - by Bioz Stars,
2026-10
92/100 stars
|
Buy from Supplier |
93
|
Addgene inc
sp 1 transcription factor cdna Sp 1 Transcription Factor Cdna, supplied by Addgene inc, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/s%2E+pneumoniae+(amri+sp1)/CMV-Sp1+(Plasmid+%2312097)/pmc03202637-31-5-13 Average 93 stars, based on 1 article reviews
sp 1 transcription factor cdna - by Bioz Stars,
2026-10
93/100 stars
|
Buy from Supplier |
93
|
Santa Cruz Biotechnology
sp 1 consensus sequence attcgatcggggcggggcgagc Sp 1 Consensus Sequence Attcgatcggggcggggcgagc, supplied by Santa Cruz Biotechnology, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more https://www.bioz.com/product/s%2E+pneumoniae+(amri+sp1)/Sp1+Gel+Shift+Oligonucleotides/pm15192014-102-10-14 Average 93 stars, based on 1 article reviews
sp 1 consensus sequence attcgatcggggcggggcgagc - by Bioz Stars,
2026-10
93/100 stars
|
Buy from Supplier |